ID: 1096537179_1096537190

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1096537179 1096537190
Species Human (GRCh38) Human (GRCh38)
Location 12:52282598-52282620 12:52282642-52282664
Sequence CCACCTGGAGTGAGAGTGACCAT CAAGCCTAGGGGTTAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 123} {0: 1, 1: 0, 2: 0, 3: 30, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!