ID: 1096537923_1096537935

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1096537923 1096537935
Species Human (GRCh38) Human (GRCh38)
Location 12:52287188-52287210 12:52287236-52287258
Sequence CCTGATCAGGCAGGCCATGTCCT CAGCTCGGCCAGCTTGCAGCGGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 0, 3: 10, 4: 133} {0: 3, 1: 2, 2: 1, 3: 20, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!