ID: 1096543695_1096543704

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1096543695 1096543704
Species Human (GRCh38) Human (GRCh38)
Location 12:52322774-52322796 12:52322823-52322845
Sequence CCATCAACCCTTCCAAACACACA GATGAGGAGGACTCCACTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 568} {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!