ID: 1096551545_1096551556

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1096551545 1096551556
Species Human (GRCh38) Human (GRCh38)
Location 12:52376882-52376904 12:52376910-52376932
Sequence CCTATAATGAACTGATGAACTGG CTGAGGGTGGGTGAGACCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 119} {0: 1, 1: 0, 2: 6, 3: 64, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!