ID: 1096559917_1096559924

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1096559917 1096559924
Species Human (GRCh38) Human (GRCh38)
Location 12:52428783-52428805 12:52428814-52428836
Sequence CCTGGCCCAGGCACTCGCTGTGC CCACCCTGGGTGCCACAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 342} {0: 1, 1: 0, 2: 3, 3: 26, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!