ID: 1096579168_1096579175

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1096579168 1096579175
Species Human (GRCh38) Human (GRCh38)
Location 12:52573435-52573457 12:52573462-52573484
Sequence CCTGGTGGATGCCCCCAGGTGGG CAGACAAACATGCAGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 191} {0: 1, 1: 0, 2: 1, 3: 16, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!