ID: 1096596337_1096596344

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1096596337 1096596344
Species Human (GRCh38) Human (GRCh38)
Location 12:52698175-52698197 12:52698201-52698223
Sequence CCCTCCACACTCAATTTATCCAT AACGTAAGGAAATGGTGTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 440} {0: 1, 1: 0, 2: 0, 3: 10, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!