ID: 1096603393_1096603399

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1096603393 1096603399
Species Human (GRCh38) Human (GRCh38)
Location 12:52746693-52746715 12:52746721-52746743
Sequence CCTCCCTGGCCTGCTGCAGGGCA GAGCTCTGCCAACTTGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 79, 4: 505} {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!