ID: 1096606692_1096606694

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1096606692 1096606694
Species Human (GRCh38) Human (GRCh38)
Location 12:52771767-52771789 12:52771804-52771826
Sequence CCATGAAAGGATGGAGAGAGCAT GAGCTTATGCTGCTTCTCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 239} {0: 1, 1: 0, 2: 1, 3: 18, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!