ID: 1096614609_1096614612

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1096614609 1096614612
Species Human (GRCh38) Human (GRCh38)
Location 12:52824713-52824735 12:52824729-52824751
Sequence CCATGGCAGGCTCACAGGGTGCC GGGTGCCTTTGTGCAAATTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 336} {0: 1, 1: 0, 2: 0, 3: 14, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!