ID: 1096615031_1096615040

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1096615031 1096615040
Species Human (GRCh38) Human (GRCh38)
Location 12:52827425-52827447 12:52827465-52827487
Sequence CCAATTCCTAAACATTCAGAAAA GAACCTAATGGACCACAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 410} {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!