ID: 1096620249_1096620254

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1096620249 1096620254
Species Human (GRCh38) Human (GRCh38)
Location 12:52860082-52860104 12:52860101-52860123
Sequence CCAGGAACAAACTGCTGGTGCCT GCCTGAGAGAGGAAGGGGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 73, 4: 674}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!