ID: 1096625866_1096625870

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1096625866 1096625870
Species Human (GRCh38) Human (GRCh38)
Location 12:52895652-52895674 12:52895677-52895699
Sequence CCTGATTCTTGCTGAGGGCCAGG ACATGTGAGCAGAAGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 208} {0: 1, 1: 0, 2: 6, 3: 53, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!