ID: 1096627361_1096627374

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1096627361 1096627374
Species Human (GRCh38) Human (GRCh38)
Location 12:52903943-52903965 12:52903969-52903991
Sequence CCGCAGCCCCTCACCCCGCCCTC CCCGCCCACGCTGCCGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 175, 4: 1803} {0: 1, 1: 0, 2: 1, 3: 20, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!