ID: 1096627364_1096627374

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1096627364 1096627374
Species Human (GRCh38) Human (GRCh38)
Location 12:52903950-52903972 12:52903969-52903991
Sequence CCCTCACCCCGCCCTCGGCCCCG CCCGCCCACGCTGCCGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 70, 4: 767} {0: 1, 1: 0, 2: 1, 3: 20, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!