ID: 1096629229_1096629239

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1096629229 1096629239
Species Human (GRCh38) Human (GRCh38)
Location 12:52915016-52915038 12:52915051-52915073
Sequence CCACATAACAAGACCCTGTGGAG CCACCCAACCTATAGAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166} {0: 1, 1: 0, 2: 0, 3: 3, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!