ID: 1096670506_1096670517

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1096670506 1096670517
Species Human (GRCh38) Human (GRCh38)
Location 12:53195764-53195786 12:53195802-53195824
Sequence CCCACAACATGCAAGGTGCCCTC GGAACCAAGGTTCCACCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 124} {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!