ID: 1096670507_1096670517

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1096670507 1096670517
Species Human (GRCh38) Human (GRCh38)
Location 12:53195765-53195787 12:53195802-53195824
Sequence CCACAACATGCAAGGTGCCCTCA GGAACCAAGGTTCCACCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125} {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!