ID: 1096673833_1096673843

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1096673833 1096673843
Species Human (GRCh38) Human (GRCh38)
Location 12:53215765-53215787 12:53215804-53215826
Sequence CCTCTGAGCTGGTGCTCTGTGTC AAGCAGTGATGTGAGGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 285} {0: 1, 1: 0, 2: 1, 3: 24, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!