ID: 1096675200_1096675203

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1096675200 1096675203
Species Human (GRCh38) Human (GRCh38)
Location 12:53222346-53222368 12:53222386-53222408
Sequence CCAGCAGCAAACAACAACAAAAA GGGAGTACCCCGAAAACAAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 16, 3: 232, 4: 1686} {0: 1, 1: 0, 2: 1, 3: 2, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!