ID: 1096677319_1096677328

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1096677319 1096677328
Species Human (GRCh38) Human (GRCh38)
Location 12:53232608-53232630 12:53232639-53232661
Sequence CCTCCCCAGGGTAGGCAATGGGG ACTCCCTCCCAGTGCTGGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 212} {0: 1, 1: 0, 2: 1, 3: 14, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!