ID: 1096677542_1096677554

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1096677542 1096677554
Species Human (GRCh38) Human (GRCh38)
Location 12:53233720-53233742 12:53233767-53233789
Sequence CCCCAGGTGGCCTAGCTGCTGTT CAGCTCTCAGCAGTGTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210} {0: 1, 1: 0, 2: 2, 3: 36, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!