ID: 1096677544_1096677554

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1096677544 1096677554
Species Human (GRCh38) Human (GRCh38)
Location 12:53233722-53233744 12:53233767-53233789
Sequence CCAGGTGGCCTAGCTGCTGTTGA CAGCTCTCAGCAGTGTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 218} {0: 1, 1: 0, 2: 2, 3: 36, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!