ID: 1096686815_1096686826

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1096686815 1096686826
Species Human (GRCh38) Human (GRCh38)
Location 12:53293399-53293421 12:53293449-53293471
Sequence CCGCCAAGCTCCCCGACTCAAGT ATGGCTTGCCTGTCTCTCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 226} {0: 1, 1: 0, 2: 0, 3: 19, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!