ID: 1096691538_1096691555

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1096691538 1096691555
Species Human (GRCh38) Human (GRCh38)
Location 12:53325053-53325075 12:53325090-53325112
Sequence CCGGAGCTCCGCCCGCTACCCCT GAGCCCGGCGTCCCGACCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 157} {0: 1, 1: 1, 2: 0, 3: 6, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!