ID: 1096691542_1096691555

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1096691542 1096691555
Species Human (GRCh38) Human (GRCh38)
Location 12:53325064-53325086 12:53325090-53325112
Sequence CCCGCTACCCCTTCCCGGGCCCG GAGCCCGGCGTCCCGACCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 277} {0: 1, 1: 1, 2: 0, 3: 6, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!