ID: 1096701013_1096701021

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1096701013 1096701021
Species Human (GRCh38) Human (GRCh38)
Location 12:53382783-53382805 12:53382831-53382853
Sequence CCAGCTCTCAGGCAGTCACGATC GCTCACAGCCTGTCACCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101} {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!