|
Left Crispr |
Right Crispr |
| Crispr ID |
1096711688 |
1096711696 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:53461954-53461976
|
12:53461996-53462018
|
| Sequence |
CCGCCTCAGCCTTCCAAAGTACT |
GATGCACCCAACCTGGAAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 94, 1: 4242, 2: 72565, 3: 159136, 4: 159261} |
{0: 1, 1: 0, 2: 1, 3: 12, 4: 93} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|