ID: 1096711692_1096711696

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1096711692 1096711696
Species Human (GRCh38) Human (GRCh38)
Location 12:53461967-53461989 12:53461996-53462018
Sequence CCAAAGTACTGGTATTACCAGCA GATGCACCCAACCTGGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 506, 3: 10025, 4: 122897} {0: 1, 1: 0, 2: 1, 3: 12, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!