ID: 1096715288_1096715301

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1096715288 1096715301
Species Human (GRCh38) Human (GRCh38)
Location 12:53487394-53487416 12:53487429-53487451
Sequence CCTCTGGCCCCTGGTATGATGGT CTGTGGGAATGAAGGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 152} {0: 1, 1: 1, 2: 25, 3: 286, 4: 4240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!