|
Left Crispr |
Right Crispr |
| Crispr ID |
1096721886 |
1096721890 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:53529158-53529180
|
12:53529201-53529223
|
| Sequence |
CCAGCCTGGGCAACATAGTGAGA |
ATTTAGTTATTTATTTAAGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8728, 1: 47895, 2: 121208, 3: 309924, 4: 360883} |
{0: 1, 1: 110, 2: 1437, 3: 2532, 4: 4323} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|