ID: 1096749705_1096749729

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1096749705 1096749729
Species Human (GRCh38) Human (GRCh38)
Location 12:53751217-53751239 12:53751264-53751286
Sequence CCCCTCCTCTGAGCCCTGCGGCC TGCAGGGGTTGGGGGCGCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!