ID: 1096771718_1096771731

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1096771718 1096771731
Species Human (GRCh38) Human (GRCh38)
Location 12:53939617-53939639 12:53939655-53939677
Sequence CCACCTCTGGAAGTCTCCCTTCC CCCGAGCGCCGCCGCCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 318} {0: 1, 1: 1, 2: 6, 3: 70, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!