ID: 1096776122_1096776140

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1096776122 1096776140
Species Human (GRCh38) Human (GRCh38)
Location 12:53965463-53965485 12:53965505-53965527
Sequence CCCTCTCCCCCAGGAACACCTGG GGGGCTGTGAAGGCCAGTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!