ID: 1096779038_1096779043

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1096779038 1096779043
Species Human (GRCh38) Human (GRCh38)
Location 12:53981814-53981836 12:53981835-53981857
Sequence CCCTCCTCCTCTGCATTGCTCAC ACAGCCCCACAGACAGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 531} {0: 1, 1: 0, 2: 4, 3: 27, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!