ID: 1096779049_1096779072

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1096779049 1096779072
Species Human (GRCh38) Human (GRCh38)
Location 12:53981863-53981885 12:53981915-53981937
Sequence CCCCGTCCTTGTTGCCTTTCCAG GCCAGGGCATTGGCCCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190} {0: 1, 1: 0, 2: 3, 3: 35, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!