ID: 1096788115_1096788132

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1096788115 1096788132
Species Human (GRCh38) Human (GRCh38)
Location 12:54029409-54029431 12:54029446-54029468
Sequence CCGCCCCCCCCCCCACCACACAC CACAGGTCCCACCTTATAGGAGG
Strand - +
Off-target summary {0: 1, 1: 40, 2: 360, 3: 3262, 4: 17671} {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!