ID: 1096789277_1096789282

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1096789277 1096789282
Species Human (GRCh38) Human (GRCh38)
Location 12:54034887-54034909 12:54034900-54034922
Sequence CCCTCTAACCTCGCCCTCTCCTT CCCTCTCCTTTGTTCCCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 335} {0: 1, 1: 0, 2: 0, 3: 19, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!