ID: 1096799205_1096799209

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1096799205 1096799209
Species Human (GRCh38) Human (GRCh38)
Location 12:54098263-54098285 12:54098286-54098308
Sequence CCCGTTGCAGGGAACTCCAGGCC TTCAACCAGCAGAACTATTTTGG
Strand - +
Off-target summary No data {0: 6, 1: 1, 2: 0, 3: 15, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!