ID: 1096807330_1096807342

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1096807330 1096807342
Species Human (GRCh38) Human (GRCh38)
Location 12:54148728-54148750 12:54148774-54148796
Sequence CCATAGTCCCTCCAGTACCTGGC GCTGGTTCTCTTCTCTCCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!