ID: 1096814278_1096814287

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1096814278 1096814287
Species Human (GRCh38) Human (GRCh38)
Location 12:54191820-54191842 12:54191861-54191883
Sequence CCGCTTCTCACGGGGAAGGGCTG CACTGCACAAAACAAAGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143} {0: 1, 1: 0, 2: 0, 3: 18, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!