ID: 1096829081_1096829087

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1096829081 1096829087
Species Human (GRCh38) Human (GRCh38)
Location 12:54300716-54300738 12:54300730-54300752
Sequence CCCCCTCACCTCCTTCACCCCCC TCACCCCCCAGCCTGCCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 20, 3: 228, 4: 1808} {0: 1, 1: 0, 2: 7, 3: 55, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!