ID: 1096838120_1096838129

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1096838120 1096838129
Species Human (GRCh38) Human (GRCh38)
Location 12:54364153-54364175 12:54364201-54364223
Sequence CCCGCTGCTCTCAGTAAACCCAG CCCCATCCCCAAAGACCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 205} {0: 1, 1: 0, 2: 2, 3: 31, 4: 592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!