ID: 1096860981_1096860988

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1096860981 1096860988
Species Human (GRCh38) Human (GRCh38)
Location 12:54527925-54527947 12:54527961-54527983
Sequence CCTGACAGAGGGTAAGGGTGAGG TGGAAAAGAGCAGTGGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 262} {0: 1, 1: 0, 2: 3, 3: 85, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!