ID: 1096865250_1096865255

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1096865250 1096865255
Species Human (GRCh38) Human (GRCh38)
Location 12:54558726-54558748 12:54558739-54558761
Sequence CCACCAATATCCAGGTGCCATCT GGTGCCATCTGAGGCCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161} {0: 1, 1: 0, 2: 5, 3: 24, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!