ID: 1096882917_1096882920

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1096882917 1096882920
Species Human (GRCh38) Human (GRCh38)
Location 12:54687179-54687201 12:54687218-54687240
Sequence CCTGGATACTTCATGGTCTCTAG GGACCCTGGACCCACTCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96} {0: 1, 1: 0, 2: 8, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!