ID: 1096913704_1096913714

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1096913704 1096913714
Species Human (GRCh38) Human (GRCh38)
Location 12:55009821-55009843 12:55009873-55009895
Sequence CCCCGCAAATTACCACAGGAGGT TGGCCACAGCTGGTACCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55} {0: 1, 1: 0, 2: 5, 3: 27, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!