ID: 1096924106_1096924110

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1096924106 1096924110
Species Human (GRCh38) Human (GRCh38)
Location 12:55123110-55123132 12:55123148-55123170
Sequence CCATCACTGCCTGAACTTAGGGA ACTCTGCTCTCCACTCTGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 25, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!