|
Left Crispr |
Right Crispr |
| Crispr ID |
1096960340 |
1096960344 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:55570708-55570730
|
12:55570735-55570757
|
| Sequence |
CCCATATTGCTATCAGTATTTTG |
AAGCCATTCAACAAGACTCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 25, 3: 78, 4: 369} |
{0: 15, 1: 1500, 2: 1902, 3: 1418, 4: 885} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|