ID: 1096973396_1096973407

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1096973396 1096973407
Species Human (GRCh38) Human (GRCh38)
Location 12:55684841-55684863 12:55684875-55684897
Sequence CCCTGTCCCTGATTTACCCACTC CACTCTAAGGGGAAGTTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 236} {0: 1, 1: 0, 2: 0, 3: 18, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!